isopropyl β d 1 thiogalactopyranoside (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
94
Structured Review
Thermo Fisher
isopropyl β d 1 thiogalactopyranoside
Isopropyl β D 1 Thiogalactopyranoside, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biochemistry/Isopropyl-beta-D-thiogalactopyranoside%2C+99%25%2C+for+biochemistry%2C+dioxane-free/pmc13315006-236-20-11
Average 94 stars, based on 1 article reviews
Isopropyl β D 1 Thiogalactopyranoside, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biochemistry/Isopropyl-beta-D-thiogalactopyranoside%2C+99%25%2C+for+biochemistry%2C+dioxane-free/pmc13315006-236-20-11
Average 94 stars, based on 1 article reviews
isopropyl β d 1 thiogalactopyranoside - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
other:Article Title: PRDX6 dictates ferroptosis sensitivity by directing cellular selenium utilization. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: 786-O PRDX6 KO This paper N/A Human: A375 PRDX6 KO This paper N/A Human: A549 PRDX6 KO This paper N/A Human: NCI-H460 PRDX6 KO This paper N/A Human: LOX-IMVI PRDX6 KO This paper N/A Human: HEC151 PRDX6 KO This paper N/A 4-hydroxytamoxifen inducible Gpx4 knockout MEFs (Pfa1 cells) Seiler et al.31 N/A Mouse: Pfa1 Gpx4 KO Nakamura et al.30 N/A Mouse: Pfa1 Gpx4 KO + HA-mPRDX6 OE This paper N/A Mouse: Pfa1 Gpx4 KO + HA-hFSP1 OE Nakamura et al.35 N/A Mouse: Pfa1 Gpx4 KO + HA-hGCH1 OE This paper N/A Mouse: Pfa1 + hPRDX6 OE This paper N/A Mouse: Pfa1 + FSH-hPRDX6 OE This paper N/A Experimental models: Organisms/strains BALB/c nude mice (CAnN.Cg-Foxn1nu/Crl) Charles River N/A Prdx6 knockout mice (Prdx6tm1Abf/Mmjax) Jackson Laboratory MMRRC_043402-JAX Oligonucleotides hPRDX6 sg1_GATAGGATGGGGATAGTGTGA This paper N/A hPRDX6 sg2_GCTCTGTGGTGCACACTG This paper N/A hPRDX6 sg3_GACACTGGGGTAAAGTCCCGA This paper N/A hPRDX1 sg1_GAAAGCAATGATCTCCGTG This paper N/A hPRDX2 sg1_GTTGATGGCGCCTTCAAAG This paper N/A hPRDX3 sg1_GCAGTGGCAGAAATGCCCCA This paper N/A hPRDX4 sg1_GTATTACTTACAAATCAAGT This paper N/A hPRDX5 sg1_GCTCCTGGCTGATCCCACTG This paper N/A mPrdx6 sg1_GACACTGGGGTAAAGTCCCGT This paper N/A Software and algorithms GraphPad Prism v10 GraphPad Software https://www.graphpad.com Analyst v1.7.2 Sciex https://sciex.com/ SoftMax Pro v7 Molecular devices https://www.moleculardevices.com/ Image Lab v6.0 Bio rad https://www.bio-rad.com/ 3D Cell Explorer and Software:Article Title: Proximity labeling reveals OTUD3 as a DNA-binding deubiquitinase of cGAS. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 3-Methyladenine (3-MA) MedChemExpress Cat# HY-19312, CAS No.5142-23-4 Cycloheximide (CHX) MedChemExpress Cat# HY-12320, CAS No.66-81-9 RNAiso Plus Takara Cat# 9109 Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) Yeason Cat# 11141ES10 Hieff UNICON Universal Blue qPCR SYBR Green Master Mix Yeason Cat# 11184ES08 Amicon ultra 0.5mL 10K Millipore Cat# UFC5010BK LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668019 EZ Trans Life iLab Bio Cat# C4058L1092 2030-cGAMP Lab-made Hou et al., 2021 Recombinant Human Ubiquitin AMC R&D Cat# U-550 Nhe I New England Biolabs Cat# R3131S EcoR I New England Biolabs Cat# R3101S BamHI-HF New England Biolabs Cat# R3136L Critical commercial assays Hieff Clone Plus One Step Cloning Kit Yeason Cat# 10911ES20 2030-cGAMP ELISA Kit ARBOR ASSAYS Cat# K067-H5 Red Blood Cell Lysis Buffer Beyotime Cat# C3702 Deposited data Proteomics data This Study iProx: PXD040544 (https://www.iprox.cn) Experimental models: Cell lines HEK 293T STING-Flag Lab-made Hou et al., 2021 HEK 293T OTUD3 knockdown This Study N/A THP-1 OTUD3 knockdown This Study N/A THP-1 Flag-OTUD3 This Study N/A HeLa cGAS knockout This Study N/A L929 Otud3 knockdown This Study N/A L929 OTUD3 rescue This Study N/A MEFs This Study N/A BMDMs This Study N/A Experimental models: Organisms/strains WT and Otud3 / C57BL/6J mice Shanghai Model Organisms Center N/A Oligonucleotides primers for Recombinant DNA, see Table S1 This study N/A qPCR primers, see Table S1 This study N/A shRNA sequences, see Table S1 This study N/A Recombinant DNA pRSFDuet-1-human cGAS Gao Pu (Institute of Biophysics) N/A pCDNA3-HA-MAVS Fajian Hou (Shanghai Institute of Biochemistry and Cell Biology) N/A psPAX2 Hu Junhao (Shanghai Institute of Organic Chemistry) N/A pMD2.G Hu Junhao (Shanghai Institute of Organic Chemistry) N/A pLKO.1-shGFP Junying Yuan (Shanghai Institute of Organic Chemistry) N/A pLKO.1 Junying Yuan (Shanghai Institute of Organic Chemistry) N/A pCDH Ji Cao (Zhejiang University) N/A (Continued on next page) 16 Cell Reports 42, 112309, April 25, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pSin-TurboID-Flag This Study N/A pSin-Flag-TurboID-cGAS This Study N/A pSin-GFP-Flag This Study N/A pSin-Flag-cGAS This Study N/A pSin-GFP-cGAS This Study N/A pSin-Flag-OTUD3 This Study N/A pSin-HA-OTUD3 This Study N/A pSin-HA-cGAS This Study N/A pGEX6P1-GST-OTUD3-Flag This Study N/A pGEX6P1-GST-OTUD3 This Study N/A pSin-HA-OTUD3 OTU This Study N/A pSin-HA-OTUD3 OTU+UBA This Study N/A pSin-HA-OTUD3 UBA This Study N/A pSin-HA-OTUD3 UBA+Tail This Study N/A pSin-HA-OTUD3 GFP+Tail This Study N/A pSin-HA-cGAS NTD This Study N/A pSin-HA-cGAS NTD+NTase This Study N/A pSin-HA-cGAS NTase This Study N/A pSin-HA-cGAS NTase+CTD This Study N/A pSin-HA-cGAS CTD This Study N/A pSin-Flag-DDX41 This Study N/A pSin-Flag-IFI16 This Study N/A pSin-Flag-DHX36 This Study N/A pGEX-6P-1 This Study N/A pGEX6P1-GST-OTUD3 (1-50) This Study N/A pGEX6P1-GST-OTUD3 (313-380) This Study N/A pGEX6P1-GST-OTUD3 (del 1-50) This Study N/A pGEX6P1-GST-OTUD3 (del 346-380) This Study N/A pGEX6P1-GST-OTUD3 (del 1-50,346-380) This Study N/A pSin-HA-OTUD3 (del 1-50,346-380) This Study N/A pSin-Myc-Ub This Study N/A pSin-Myc-Ub K0 This Study N/A pSin-Myc-Ub K6 This Study N/A pSin-Myc-Ub K11 This Study N/A pSin-Myc-Ub K27 This Study N/A pSin-Myc-Ub K29 This Study N/A pSin-Myc-Ub K33 This Study N/A pSin-Myc-Ub K48 This Study N/A pSin-Myc-Ub K63 This Study N/A pSin-Flag-OTUD3 C76A This Study N/A pCDH(GFP) This Study N/A pCDH(GFP)-Flag-OTUD3 This Study N/A pCDH(GFP)-Flag-OTUD3 C76A This Study N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software https://www.graphpad.com/ MaxQuant software (version 1.5.3.30) Max Planck Institute of |